Hoja de datos de bioinformática para tontos

De Bioinformatics For Dummies, 2ª Edición

Por Jean-Michel Claverie, Cedric Notredame

La bioinformática es la unión de la biología molecular y la tecnología de la información. Los sitios web le dirigen a los datos bioinformáticos básicos y le ayudan a analizar las secuencias de ADN/ARN y proteínas. Todos estos datos se presentan en varios formatos, por lo que familiarizarse con los distintos tipos de formato le ayuda a saber cómo interpretar y almacenar los datos.

Dónde encontrar datos bioinformáticos

La bioinformática combina la tecnología de la información y la biología molecular, por lo que tiene sentido que Internet sea el principal escenario para la búsqueda de información bioinformática. La siguiente lista ofrece enlaces a sitios Web útiles en todo el mundo y a las áreas en las que se especializan:

Sitios web bioinformáticos para el análisis de secuencias de ADN/ARN

Los sitios web de bioinformática de la siguiente lista ofrecen ayuda para analizar las secuencias de ADN y ARN. Y, en la unión de la tecnología de la información y la biología molecular que es la bioinformática, este tipo de análisis es de lo que se trata.

Sitios web de bioinformática para el análisis de secuencias de proteínas

Con la bioinformática se puede explorar la biología molecular utilizando la tecnología de la información. Los enlaces a los sitios web de la siguiente lista se centran en las secuencias de proteínas. Algunos ofrecen bases de datos con capacidad de búsqueda, otros le ayudan a investigar una sola proteína; todos son útiles:

Formatos de datos bioinformáticos

Cuando utilizas Internet para ayudar en tu proyecto de bioinformática, te encuentras con datos en todo tipo de formatos diferentes. La siguiente tabla puede ayudarle a entender los formatos bioinformáticos comunes y lo que puede y no puede hacer con ellos.

Formato NameDescriptionRAWSequence formato que no contiene ningún encabezado. Espacios y
Este es el formato por defecto. Formato de secuencia que contiene un
línea de encabezado y la secuencia: >nombre
AGCTGTGTGGGGTTTGTGGGGTTTPIRSequence formato que es similar a FASTA pero menos comúnMSFMultiple sequence alignment formatCLUSTALMultiple sequence alignment format (funciona con T-Coffee)TXTTText formatGIF, JPEG, PNG, PDFGraphic formats. No los use para almacenar información importante.
información.

Responder